c1d

Ensembl ID:
ENSDARG00000021112
ZFIN ID:
ZDB-GENE-041024-8
Description:
Nuclear nucleic acid-binding protein C1D [Source:UniProtKB/Swiss-Prot;Acc:Q5XJ97]
Human Orthologue:
C1D
Human Description:
C1D nuclear receptor corepressor [Source:HGNC Symbol;Acc:29911]
Mouse Orthologue:
C1d
Mouse Description:
C1D nuclear receptor co-repressor Gene [Source:MGI Symbol;Acc:MGI:1927354]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11551 Nonsense Available for shipment Available now
sa42128 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023803 Nonsense 85 148 4 5
Genomic Location (Zv9):
Chromosome 13 (position 4317669)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4534499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGTATCTTGTGACACAAGGAGTCAATCCGAAAKACCATCCAATYAAA[C/T]AAGAACTGGTAAGAGAATWCTGTCRGTTTACTTCAAACNTTTTTTTTCTK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023803 Essential Splice Site 87 148 4 5
Genomic Location (Zv9):
Chromosome 13 (position 4317659)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4534489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACACAAGGAGTCAATCCGAAAGACCATCCAATCAAACAAGAACTGG[T/C]AAGAGAATACTGTCGGTTTACTTCAAACGTTTTTTTTCTGTGACAATGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link