poc1b

Ensembl ID:
ENSDARG00000021110
ZFIN ID:
ZDB-GENE-031118-54
Description:
POC1 centriolar protein homolog B [Source:UniProtKB/Swiss-Prot;Acc:A2CEH0]
Human Orthologue:
POC1B
Human Description:
POC1 centriolar protein homolog B (Chlamydomonas) [Source:HGNC Symbol;Acc:30836]
Mouse Orthologue:
Poc1b
Mouse Description:
POC1 centriolar protein homolog B (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1918511]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11463 Nonsense Available for shipment Available now
sa44270 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32526 Essential Splice Site Available for shipment Available now
sa7529 Missense Mutation detected in F1 DNA During 2017
sa30751 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004771 Nonsense 45 490 3 12
Genomic Location (Zv9):
Chromosome 25 (position 18921824)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18338134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAATAATTTTGCAGCTACTGGATCCTGTGATAAAAGCCTTATGATTT[G/A]GAACCTCGCTCCTAAAGCCCGGGCTTTCAGGTTTGTGGGTCACACAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004771 Essential Splice Site 187 490 5 12
Genomic Location (Zv9):
Chromosome 25 (position 18919654)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18335964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGATACATCCTCACATCAGTGCATCAACATTTTCACAGACTATGGAGG[G/T]TGAGAATTAAGTGTTTCTGGTCATTTTTGGAAATTTTTAAGTATCTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004771 Essential Splice Site 369 490 10 12
Genomic Location (Zv9):
Chromosome 25 (position 18913555)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18329865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTGACCCTCAGGTGGTTGAAGTGGGACGTGTTGTTTTCTCCACAACG[G/A]TAAGAATTCTCAACAATCTGGTTAATGAAATGATTTAGTCCAAGCACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004771 Missense 434 490 11 12
Genomic Location (Zv9):
Chromosome 25 (position 18856876)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18273186
KASP Assay ID:
554-4386.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCCAGCAGAGCGCTCTGGTATTCCATCAAGCCTTACTAGCACTCTGG[A/C]GAACATTGTRCAGCAGCTGGACATCCTGACCCAGGTGAATTTATTTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004771 Nonsense 477 490 12 12
Genomic Location (Zv9):
Chromosome 25 (position 18855167)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18271477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAGGACCTGCCTGGACAATCAGGTCCTGCTTATGCAACAAAACCAA[C/T]AATTAGACCGATCTGACGAGGAATCCGAGGGACCCCCGTTGTGATGGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link