th1l

Ensembl ID:
ENSDARG00000021097
ZFIN ID:
ZDB-GENE-040426-720
Description:
TH1-like [Source:RefSeq peptide;Acc:NP_957484]
Human Orthologue:
TH1L
Human Description:
TH1-like (Drosophila) [Source:HGNC Symbol;Acc:15934]
Mouse Orthologue:
Th1l
Mouse Description:
TH1-like homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1926424]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20815 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008959 Nonsense 81 579 3 15
Genomic Location:
Chromosome 6 (position 49751405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGAGCACGTGATTCAGCTCCTCTCGGAGAATTACTCTGCTGTCGCA[C/T]AGACCGTCAATCTGCTGGCCGAGTGGCTCATTCAAATGGGTCAGTGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nn7tnd22