sec31a

Ensembl ID:
ENSDARG00000021082
ZFIN ID:
ZDB-GENE-020919-2
Description:
Protein transport protein Sec31A [Source:UniProtKB/Swiss-Prot;Acc:Q7SYD5]
Human Orthologue:
SEC31A
Human Description:
SEC31 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:17052]
Mouse Orthologue:
Sec31a
Mouse Description:
Sec31 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1916412]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1082 Nonsense F2 line generated During 2017
sa41581 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34821 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31763 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1082
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108587 Nonsense 146 1250 5 28
ENSDART00000138537 Nonsense 146 1237 5 28
Genomic Location (Zv9):
Chromosome 10 (position 5133149)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5129443
KASP Assay ID:
554-0984.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTCTTTAACTTAGTCAAACCTTGTGGCGTCTGGTGGAAATGAGTCC[G/T]AAATCTACATTTGGGATTTGAACAACTTCAGCTCCCCAATGACACCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108587 Essential Splice Site 399 1250 10 28
ENSDART00000138537 Essential Splice Site 399 1237 10 28
Genomic Location (Zv9):
Chromosome 10 (position 5128238)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5124532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAACCTCCAAAATGGATCCGTAGACCAGTTGGAGCATCTTTTGCTG[T/A]AAGTGGCTCTAAATCTAGCATTGCACATTGAATATGCACTAATAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108587 Essential Splice Site 476 1250 11 28
ENSDART00000138537 Essential Splice Site 476 1237 11 28
Genomic Location (Zv9):
Chromosome 10 (position 5127923)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5124217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAACTGTTCAGAATGAATTTGAGAGGACTGTTTGGTCATTTCTGAAG[G/A]TAAGACACTCGATTAAGAATGCTTAATTGTGTGCACAGGAACAGGTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108587 Nonsense 786 1250 19 28
ENSDART00000138537 Nonsense 788 1237 19 28
Genomic Location (Zv9):
Chromosome 10 (position 5114209)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5110503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGATGATTTTTATTTTTAGGTTTCTGTGCAGCAGTTGCGAGAGCGTT[T/A]AAGCAGAGCTTTAGGACAGCATCAGCATCCTCAACAGCCTGCAGCTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link