camk2b2

Ensembl ID:
ENSDARG00000021065
ZFIN ID:
ZDB-GENE-090312-34
Human Orthologue:
CAMK2B
Human Description:
calcium/calmodulin-dependent protein kinase II beta [Source:HGNC Symbol;Acc:1461]
Mouse Orthologue:
Camk2b
Mouse Description:
calcium/calmodulin-dependent protein kinase II, beta Gene [Source:MGI Symbol;Acc:MGI:88257]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41741 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044837 Essential Splice Site 172 517 7 20
ENSDART00000133694   None 165 None 5
ENSDART00000134906 Essential Splice Site 172 314 7 12
Genomic Location (Zv9):
Chromosome 10 (position 46258121)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45252955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTTGGTCTGGCCATCGAAGTACAGGGAGACCAGCAGGCCTGGTTCGG[T/A]ATGCGAACACTGCAGACTCTGCTTTGCATCATTTCTTGATTAATTTGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link