alas1

Ensembl ID:
ENSDARG00000021059
ZFIN ID:
ZDB-GENE-001229-2
Description:
5-aminolevulinate synthase, nonspecific, mitochondrial [Source:RefSeq peptide;Acc:NP_958444]
Human Orthologue:
ALAS1
Human Description:
aminolevulinate, delta-, synthase 1 [Source:HGNC Symbol;Acc:396]
Mouse Orthologue:
Alas1
Mouse Description:
aminolevulinic acid synthase 1 Gene [Source:MGI Symbol;Acc:MGI:87989]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21822 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005217 Essential Splice Site 560 613 9 10
Genomic Location:
Chromosome 11 (position 246969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCCCCGACACCACACCACACACCCCAGATGATGAAATACTTTGTGG[G/A]TGAGTACACACACTCACACACATACACACATACACACACACACACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t9br7ber