isl1l

Ensembl ID:
ENSDARG00000021055
ZFIN ID:
ZDB-GENE-040624-1
Description:
islet1, like [Source:RefSeq peptide;Acc:NP_001002043]
Human Orthologue:
ISL1
Human Description:
ISL LIM homeobox 1 [Source:HGNC Symbol;Acc:6132]
Mouse Orthologue:
Isl1
Mouse Description:
ISL1 transcription factor, LIM/homeodomain Gene [Source:MGI Symbol;Acc:MGI:101791]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34848 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011987 Nonsense 185 323 4 6
Genomic Location (Zv9):
Chromosome 10 (position 8775361)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8851317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGAGGGCGACCCGCGTCAGGACGGTTCTCAGTGAGACTCAGCTCTG[C/A]ATGCTTCAGACCTGTTACACTGCAAATCCCAGACCTGATGCTCTCATGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link