A5D6S4_DANRE

Ensembl ID:
ENSDARG00000021004
Description:
LOC565774 protein [Source:UniProtKB/TrEMBL;Acc:A5D6S4]
Human Orthologue:
C5
Human Description:
complement component 5 [Source:HGNC Symbol;Acc:1331]
Mouse Orthologue:
Hc
Mouse Description:
hemolytic complement Gene [Source:MGI Symbol;Acc:MGI:96031]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5335 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17323 Nonsense Available for shipment Available now
sa20567 Nonsense Mutation detected in F1 DNA During 2014
sa20568 Essential Splice Site Available for shipment Available now
sa18825 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5336 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002540 Essential Splice Site 224 1050 6 25
ENSDART00000097325 Essential Splice Site 222 1702 6 43
Genomic Location:
Chromosome 5 (position 66665807)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAATTTTGAAACGACTGCTACTGCTGAGTTTGAGGTCAAAGAATATGG[T/C]AAGGCCGCCATTTATGTTTCAACTGGCTGTGCAGACCTTTARAGTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002540 Nonsense 509 1050 13 25
ENSDART00000097325 Nonsense 507 1702 13 43
Genomic Location:
Chromosome 5 (position 66676688)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTCCWCTGGATTACTCTTCTCCCCCCCCCGCCCCCCAGATCATCTCC[A/T]AAGGAAAAGTAGTRAAATACRACACAGTCAAGCGTGTCAGTGAAAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002540 Nonsense 566 1050 13 25
ENSDART00000097325 Nonsense 564 1702 13 43
Genomic Location:
Chromosome 5 (position 66676859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGGAGGAGAAAGCTGAGCTGGTGGCAGACTCTACATGGATCGATGTC[A/T]AGGCTAAATGTGTGAAAAACTTAAATGTAATGTCTTTTTCTCTCTCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002540 Essential Splice Site 768 1050 18 25
ENSDART00000097325 Essential Splice Site 764 1702 19 43
Genomic Location:
Chromosome 5 (position 66683664)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGGATCTTCGTAAAGAGAATGCAGAAAATATCATTCTAAGCCGGGCAG[G/A]TATGGATGTTTCTCACATGGCATAATATTGACTTGGATTATTAATGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002540 Essential Splice Site 870 1050 21 25
ENSDART00000097325 Essential Splice Site 866 1702 22 43
ENSDART00000002540 Essential Splice Site 870 1050 21 25
ENSDART00000097325 Essential Splice Site 866 1702 22 43
Genomic Location:
Chromosome 5 (position 66689249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCTGCTCAAGGGTTCAGTCTACAATCAGCGCTCTTCAGGCATTAAGG[T/G]GAGAGCTTCACTTTTTATTCAGGGGGATATGTTTAAAAAAATTATATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002540 Essential Splice Site 870 1050 21 25
ENSDART00000097325 Essential Splice Site 866 1702 22 43
ENSDART00000002540 Essential Splice Site 870 1050 21 25
ENSDART00000097325 Essential Splice Site 866 1702 22 43
Genomic Location:
Chromosome 5 (position 66689249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCTGCTCAAGGGTTCAGTCTACAATCAGCGCTCTTCAGGCATTAAGG[T/G]GAGAGCTTCACTTTTTATTCAGGGGGATATGTTTAAAAAAATTATATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bfzrcsuz