uncx

Ensembl ID:
ENSDARG00000020961
ZFIN ID:
ZDB-GENE-080509-1
Human Orthologue:
UNCX
Human Description:
UNC homeobox [Source:HGNC Symbol;Acc:33194]
Mouse Orthologue:
Uncx
Mouse Description:
UNC homeobox Gene [Source:MGI Symbol;Acc:MGI:108013]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18205 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055157 Nonsense 110 483 2 3
Genomic Location:
Chromosome 3 (position 43260388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAGCCCGGGTTGTAAAAGAAGACGAACTCGTACCAATTTCACTGGCTG[G/A]CAGCTGGAAGAATTAGAGAAGGCTTTTAATGAAAGTCACTATCCAGATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/leewvxte