hgs

Ensembl ID:
ENSDARG00000020960
ZFIN ID:
ZDB-GENE-030131-6107
Description:
hepatocyte growth factor-regulated tyrosine kinase substrate [Source:RefSeq peptide;Acc:NP_956162]
Human Orthologue:
HGS
Human Description:
hepatocyte growth factor-regulated tyrosine kinase substrate [Source:HGNC Symbol;Acc:4897]
Mouse Orthologue:
Hgs
Mouse Description:
HGF-regulated tyrosine kinase substrate Gene [Source:MGI Symbol;Acc:MGI:104681]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20125 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa9499 Nonsense Available for shipment Available now
sa12053 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019661 Essential Splice Site 249 447 None 22
ENSDART00000056622 Missense 259 773 9 21
ENSDART00000131913 Essential Splice Site 249 721 None 20

The following transcripts of ENSDARG00000020960 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 47669636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACTTCCCCCTGAGTACCTGACCAGCCCTCTGTCCCAGCAGTCTCAGG[T/C]AGTGCCCACCGAATCAGTAAGTAGTTGCATTTCATAGAGGGCTTTTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019661 Nonsense 338 447 13 22
ENSDART00000056622 Nonsense 353 773 13 21
ENSDART00000131913 Nonsense 338 721 13 20

The following transcripts of ENSDARG00000020960 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 47673447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATTATGTTTGTTTTYAGYTGGCCCGTTACCTGAACAGAACTTACTGG[G/T]AAAAAAAACAAGAAGAGGTTCGCAAGRGCCCCACCCCCTCTGCTCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019661 None None 447 19 22
ENSDART00000056622 Nonsense 639 773 18 21
ENSDART00000131913 Nonsense 623 721 18 20

The following transcripts of ENSDARG00000020960 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 47681402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTRTTCTTCCACTTACTCTCTTTTAGATCCCAACATGGTGAATGYTTA[C/A]ATGTATCAGACTGYGGGCAATAGTGGGCAGCCRGCAGCCCCAGGACAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6ailibao