pck2

Ensembl ID:
ENSDARG00000020956
ZFIN ID:
ZDB-GENE-040426-2266
Description:
phosphoenolpyruvate carboxykinase [Source:RefSeq peptide;Acc:NP_998357]
Human Orthologue:
PCK2
Human Description:
phosphoenolpyruvate carboxykinase 2 (mitochondrial) [Source:HGNC Symbol;Acc:8725]
Mouse Orthologue:
Pck2
Mouse Description:
phosphoenolpyruvate carboxykinase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1860456]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44105 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17973 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024084 Essential Splice Site 214 636 4 10
Genomic Location (Zv9):
Chromosome 24 (position 12833856)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12785304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTGTTCGCTGCCAGCACTCTGTGGGCAGACCTTTACCACTTAAAGG[T/G]ACATTAACTGCTGTATTTTAATATCAGATCAGCTAGAATCAGAGAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024084 Nonsense 454 636 9 10
Genomic Location (Zv9):
Chromosome 24 (position 12827967)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12779415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTGTWGTAAGCRTTTTATTYATGTTTTCCAGGTGTGCCTTTGGTGTA[T/A]GAGTCATTTAACTGGCGTCATGGTGTGTTCGTTGGTGCAGCTATGAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link