dnajb6b

Ensembl ID:
ENSDARG00000020953
ZFIN ID:
ZDB-GENE-040426-1122
Description:
DnaJ (Hsp40) homolog, subfamily B, member 6b [Source:RefSeq peptide;Acc:NP_956599]
Human Orthologues:
DNAJB6, DNAJB7, DNAJB8
Human Descriptions:
DnaJ (Hsp40) homolog, subfamily B, member 6 [Source:HGNC Symbol;Acc:14888]
DnaJ (Hsp40) homolog, subfamily B, member 7 [Source:HGNC Symbol;Acc:24986]
DnaJ (Hsp40) homolog, subfamily B, member 8 [Source:HGNC Symbol;Acc:23699]
Mouse Orthologues:
Dnajb3, Dnajb6, Dnajb7, Dnajb8
Mouse Descriptions:
DnaJ (Hsp40) homolog, subfamily B, member 3 Gene [Source:MGI Symbol;Acc:MGI:1306822]
DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI Symbol;Acc:MGI:1344381]
DnaJ (Hsp40) homolog, subfamily B, member 7 Gene [Source:MGI Symbol;Acc:MGI:1914012]
DnaJ (Hsp40) homolog, subfamily B, member 8 Gene [Source:MGI Symbol;Acc:MGI:1922801]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17305 Nonsense Available for shipment Available now
sa40972 Nonsense Mutation detected in F1 DNA During 2017
sa38633 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14449 Essential Splice Site Available for shipment Available now
sa34138 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010035 Nonsense 24 237 3 8
ENSDART00000127993 Nonsense 24 311 2 9
Genomic Location (Zv9):
Chromosome 7 (position 41959766)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40296076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AMATTTAAGATGTCTTGCTTTGAAAAAGGTGTGTATGTGCTTTTNCAGGTA[C/A]AGAAAACTTGCACTAAARTGGCATCCAGACAAAAACCCCAATGACAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010035 Nonsense 54 237 3 8
ENSDART00000127993 Nonsense 54 311 2 9
Genomic Location (Zv9):
Chromosome 7 (position 41959676)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40295986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACAAAGAGGAGGCGGAGAAAAGGTTCAAAGAAATCTCAGAAGCATA[T/A]GAAGTCCTGTCAGATGGTATTGGATATTTATTTTTTCTATAATTATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010035 Essential Splice Site 154 237 6 8
ENSDART00000127993 Essential Splice Site 154 311 5 9
Genomic Location (Zv9):
Chromosome 7 (position 41955312)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40291622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCTGGATTTTCTCCATTTGGTCCGTCCTTTTCTGGATTTGACACAG[G/A]TATGTTAATCTGTGTGCAGCTCAGTGTTTCTCAAACCTTTTCTGTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010035 Essential Splice Site 203 237 8 8
ENSDART00000127993 Essential Splice Site 203 311 7 9
Genomic Location (Zv9):
Chromosome 7 (position 41953730)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40290040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTAAGTTTATTCAATGCAAATCTCACAGGTAACGTTTGTGTCATTGCA[G/A]TATTGTAGAGAACGGTCAAGAGAGAGTGGAGGTAGAGGAGGACGGTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010035   None 237 None 8
ENSDART00000127993 Nonsense 252 311 8 9
Genomic Location (Zv9):
Chromosome 7 (position 41934382)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40270692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGAGACAGAACACTCTCTGTGGTCCTGCCCCACACAACCGATACCTC[C/T]GAAACGTGGCCCAGAACCCTTCAGAAAAGGAGGAGGTGGAGGAGGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link