si:ch211-214j8.1

Ensembl ID:
ENSDARG00000020952
ZFIN ID:
ZDB-GENE-060526-100
Description:
N-acetylated-alpha-linked acidic dipeptidase-like protein [Source:RefSeq peptide;Acc:NP_001091660]
Human Orthologue:
NAALADL1
Human Description:
N-acetylated alpha-linked acidic dipeptidase-like 1 [Source:HGNC Symbol;Acc:23536]
Mouse Orthologue:
Naaladl1
Mouse Description:
N-acetylated alpha-linked acidic dipeptidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2685810]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33603 Nonsense Mutation detected in F1 DNA During 2017
sa7565 Missense Mutation detected in F1 DNA During 2017
sa14612 Nonsense Available for shipment Available now
sa33604 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Nonsense 109 740 2 19
Genomic Location (Zv9):
Chromosome 5 (position 27893488)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25648786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCCAAAACAGGCTTGGACAGTGCATGGAGGGAGGACTACAAGGTGTA[T/G]CTGTCATTTCCAAACAAGGATAATCCTAACAAAGTCTCTGTTGGTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Missense 457 740 12 19
Genomic Location (Zv9):
Chromosome 5 (position 27899731)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25655029
KASP Assay ID:
554-4347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTYGCACTGCTGAAATGTTCTTTGTCCACAACAGCTAATGCCACTC[T/C]CAGAGCCTCAGCTTCTCCAGCAGCACAGAGTGTGCTTTTTACCGCCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Nonsense 495 740 13 19
Genomic Location (Zv9):
Chromosome 5 (position 27899931)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25655229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCGGGACAACCATGTCAGTCTATGACAACTGGATACGGTATTACAAC[A/T]GAACCAGTCCAAATTATGGGATTATACCWAAGTATGCTCWTAAWTTTATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079049 Essential Splice Site 505 740 13 19
Genomic Location (Zv9):
Chromosome 5 (position 27899964)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25655262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATACGGTATTACAACAGAACCAGTCCAAATTATGGGATTATACCTAAG[T/C]ATGCTCTTAATTTTATTCAGTACCACCTCATAGTTCAGCTTTTAATACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link