gmcl1

Ensembl ID:
ENSDARG00000020948
ZFIN ID:
ZDB-GENE-030131-865
Description:
germ cell-less protein-like 1 [Source:RefSeq peptide;Acc:NP_996933]
Human Orthologue:
GMCL1
Human Description:
germ cell-less homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:23843]
Mouse Orthologues:
Gm10921, Gm10922, Gm14345, Gm14346, Gm14347, Gm14351, Gm14374, Gm2777, Gm2784, Gm2799, Gm2825, Gm2863, Gm2913, Gm2927, Gm2933, Gm2964, Gm3701, Gm3706, Gm3750, Gm3763, Gmcl1, Gmcl1l
Mouse Descriptions:
germ cell-less homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345156]
germ cell-less homolog 1 (Drosophila)-like Gene [Source:MGI Symbol;Acc:MGI:1919097]
predicted gene 10921 Gene [Source:MGI Symbol;Acc:MGI:3709274]
predicted gene 10922 Gene [Source:MGI Symbol;Acc:MGI:3709272]
predicted gene 14345 Gene [Source:MGI Symbol;Acc:MGI:3709282]
predicted gene 14346 Gene [Source:MGI Symbol;Acc:MGI:3709280]
predicted gene 14347 Gene [Source:MGI Symbol;Acc:MGI:3709183]
predicted gene 14351 Gene [Source:MGI Symbol;Acc:MGI:3709278]
predicted gene 14374 Gene [Source:MGI Symbol;Acc:MGI:3709265]
predicted gene 2777 Gene [Source:MGI Symbol;Acc:MGI:3780946]
predicted gene 2784 Gene [Source:MGI Symbol;Acc:MGI:3780952]
predicted gene 2799 Gene [Source:MGI Symbol;Acc:MGI:3780968]
predicted gene 2825 Gene [Source:MGI Symbol;Acc:MGI:3780997]
predicted gene 2863 Gene [Source:MGI Symbol;Acc:MGI:3781040]
predicted gene 2913 Gene [Source:MGI Symbol;Acc:MGI:3781091]
predicted gene 2927 Gene [Source:MGI Symbol;Acc:MGI:3781105]
predicted gene 2933 Gene [Source:MGI Symbol;Acc:MGI:3781111]
predicted gene 2964 Gene [Source:MGI Symbol;Acc:MGI:3781142]
predicted gene 3701 Gene [Source:MGI Symbol;Acc:MGI:3781877]
predicted gene 3706 Gene [Source:MGI Symbol;Acc:MGI:3781882]
predicted gene 3750 Gene [Source:MGI Symbol;Acc:MGI:3781925]
predicted gene 3763 Gene [Source:MGI Symbol;Acc:MGI:3781937]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41588 Nonsense Mutation detected in F1 DNA During 2017
sa2548 Essential Splice Site F2 line generated During 2017
sa30649 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018017 Nonsense 207 503 7 15
Genomic Location (Zv9):
Chromosome 10 (position 6704351)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7729763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTTGACACTTTACTGAGGCTGTTGCATGTTGCAGATGTTTAGAGTG[G/A]CTCCTCAATAACCTGATGACGCATCAGAATGTGGAGCTAATGAAGGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2548
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018017 Essential Splice Site 457 503 14 15
Genomic Location (Zv9):
Chromosome 10 (position 6690622)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7716034
KASP Assay ID:
554-2670.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAGTCGTTCAACAGGCTACCAGCTTGTCACCCTCGAAAAAGATCAG[G/A]TAYGACCACCGCAATAATGTCCAGTACAGCANNNNNTTTCATTTCTATRCCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018017 Nonsense 487 503 15 15
Genomic Location (Zv9):
Chromosome 10 (position 6690460)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7715872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCCTCTATACGTGTGCTGTAACTTCCTGTACACTTCACCATCCAGC[G/T]AGAGGAGAGGAGAAACAGCCGAACCAGAAAGCAGCGCCCGCAGTGTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link