LOC100150849

Ensembl ID:
ENSDARG00000020946
Human Orthologue:
AUTS2
Human Description:
autism susceptibility candidate 2 [Source:HGNC Symbol;Acc:14262]
Mouse Orthologue:
Auts2
Mouse Description:
autism susceptibility candidate 2 Gene [Source:MGI Symbol;Acc:MGI:1919847]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22621 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012712 Nonsense 574 729 12 12
Genomic Location:
Chromosome 15 (position 18967028)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGGTCCATTACCTGTAGCTGAAAGGCTGCCTTACTCACCTCAGCACT[G/A]GGAGTCTATGCGGAATGTTTACCGGGGTCTAGACCTTCCACGTAGAGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b4ntumpi