ezrl

Ensembl ID:
ENSDARG00000020944
ZFIN ID:
ZDB-GENE-050522-18
Description:
ezrin like [Source:RefSeq peptide;Acc:NP_001018326]
Human Orthologue:
EZR
Human Description:
ezrin [Source:HGNC Symbol;Acc:12691]
Mouse Orthologue:
Ezr
Mouse Description:
ezrin Gene [Source:MGI Symbol;Acc:MGI:98931]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36516 Nonsense Available for shipment Available now
sa28923 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124911 Nonsense 117 595 4 13
Genomic Location (Zv9):
Chromosome 17 (position 45601303)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45450535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTTCCTGCAAGTGAAGGAAAGCATCTTGAGCGATGAGATCTACTG[T/A]CCGCCAGAGACAGCGGTGCTGCTGGCCTCGTATGCTGTCCAGTCCAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124911 Essential Splice Site 541 595 12 13
Genomic Location (Zv9):
Chromosome 17 (position 45611830)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45461062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGATCACAGAGGCTGAGAAGAACGAGCGCGTGCAGAAACAGCTCATGG[T/C]AACACATGCTATGTGTCTACTCACAAATCTCTGCCAGTAGTTATTCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link