fam49ba

Ensembl ID:
ENSDARG00000020929
ZFIN ID:
ZDB-GENE-030131-9537
Description:
hypothetical protein LOC337591 [Source:RefSeq peptide;Acc:NP_956364]
Human Orthologues:
FAM49A, FAM49B
Human Descriptions:
family with sequence similarity 49, member A [Source:HGNC Symbol;Acc:25373]
family with sequence similarity 49, member B [Source:HGNC Symbol;Acc:25216]
Mouse Orthologues:
Fam49a, Fam49b
Mouse Descriptions:
family with sequence similarity 49, member A Gene [Source:MGI Symbol;Acc:MGI:1261783]
family with sequence similarity 49, member B Gene [Source:MGI Symbol;Acc:MGI:1923520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19797 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039717 Essential Splice Site 238 325 8 11
ENSDART00000056621 None None 256 None 9
ENSDART00000141418 None None 256 None 8
ENSDART00000146452 None None 208 None 7

The following transcripts of ENSDARG00000020929 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 31938026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGTCTGAGCACGATGGCAAGTGTGTGTAAAGTCATGTTAGAGACACC[G/A]TGAGTTGACTTTTTTTGTGTTTAATCATTGTTTCTTCTGGAATGGGGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yqcxyydd