si:ch211-69i14.4

Ensembl ID:
ENSDARG00000020924
ZFIN ID:
ZDB-GENE-070705-190
Description:
Myosin-Ic [Source:UniProtKB/Swiss-Prot;Acc:A5PF48]
Human Orthologue:
MYO1C
Human Description:
myosin IC [Source:HGNC Symbol;Acc:7597]
Mouse Orthologue:
Myo1c
Mouse Description:
myosin IC Gene [Source:MGI Symbol;Acc:MGI:106612]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16308 Nonsense Available for shipment Available now
sa20485 Nonsense Available for shipment Available now
sa33658 Nonsense Mutation detected in F1 DNA During 2017
sa38492 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25307 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40512 Nonsense Mutation detected in F1 DNA During 2017
sa30862 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 58 1026 2 31
Genomic Location (Zv9):
Chromosome 5 (position 39395881)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37195565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGACATATATTGGGTCGGTGCTGGTGTCGGTGAATCCTTACAAGGAGT[T/A]GGAGATTTACTCTAAACAGAACATGGAGCGCCACAGAGGAGTGAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 335 1026 9 31
Genomic Location (Zv9):
Chromosome 5 (position 39402688)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37202372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAGATGCAGTCTGTATGTCTGTGTTTGATTTCAGATGATCAGTCCCT[T/A]GAGTTTAGAACAGGCTCTCTCTGCTCGAGACTCTTTTGCCAAAGCCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 585 1026 17 31
Genomic Location (Zv9):
Chromosome 5 (position 39405940)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37205624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCTCAGTTTGGCTAAACTGATGGATATTCTGATGTCTAAGGAACCAT[C/A]ATATGTTCGCTGTATAAAACCCAATGATGGTAAACAGCCAGGTGAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Essential Splice Site 724 1026 21 31
Genomic Location (Zv9):
Chromosome 5 (position 39410270)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37209954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGAGGCTACAGAGAGAGAGCCAATTACCATCGCATCCGTCATGCAG[G/A]TCGGCTTTACAAATAGACTGAAAACAGACAGACAATTGTAAGAAGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Essential Splice Site 725 1026 21 31
Genomic Location (Zv9):
Chromosome 5 (position 39410271)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37209955
KASP Assay ID:
554-7706.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAGGCTACAGAGAGAGAGCCAATTACCATCGCATCCGTCATGCAGG[T/A]CGGCTTTACAAATAGACTGAAAACAGACAGACAATTGTAAGAAGAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 730 1026 22 31
ENSDART00000053511 Nonsense 730 1026 22 31
Genomic Location (Zv9):
Chromosome 5 (position 39410373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37210057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCATACCTGTTTTGTCTTTTTTATCTTGCAGTAATTGTCATCCAGT[C/A]ATGGTGGAGAGGCGTCAAAGGCCGTAGGAAAGCCAAGCACCGTAGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 730 1026 22 31
ENSDART00000053511 Nonsense 730 1026 22 31
Genomic Location (Zv9):
Chromosome 5 (position 39410373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37210057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCATACCTGTTTTGTCTTTTTTATCTTGCAGTAATTGTCATCCAGT[C/A]ATGGTGGAGAGGCGTCAAAGGCCGTAGGAAAGCCAAGCACCGTAGACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link