si:ch211-69i14.4

Ensembl ID:
ENSDARG00000020924
ZFIN ID:
ZDB-GENE-070705-190
Description:
Myosin-Ic [Source:UniProtKB/Swiss-Prot;Acc:A5PF48]
Human Orthologue:
MYO1C
Human Description:
myosin IC [Source:HGNC Symbol;Acc:7597]
Mouse Orthologue:
Myo1c
Mouse Description:
myosin IC Gene [Source:MGI Symbol;Acc:MGI:106612]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16308 Nonsense Available for shipment Available now
sa20485 Nonsense Available for shipment Available now
sa33658 Nonsense Mutation detected in F1 DNA During 2018
sa38492 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25307 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40512 Nonsense Mutation detected in F1 DNA During 2018
sa30862 Nonsense Mutation detected in F1 DNA During 2018
sa45215 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 58 1026 2 31
Genomic Location (Zv9):
Chromosome 5 (position 39395881)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37195565
GRCz11 5 37795718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGACATATATTGGGTCGGTGCTGGTGTCGGTGAATCCTTACAAGGAGT[T/A]GGAGATTTACTCTAAACAGAACATGGAGCGCCACAGAGGAGTGAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 335 1026 9 31
Genomic Location (Zv9):
Chromosome 5 (position 39402688)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37202372
GRCz11 5 37802525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAGATGCAGTCTGTATGTCTGTGTTTGATTTCAGATGATCAGTCCCT[T/A]GAGTTTAGAACAGGCTCTCTCTGCTCGAGACTCTTTTGCCAAAGCCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 585 1026 17 31
Genomic Location (Zv9):
Chromosome 5 (position 39405940)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37205624
GRCz11 5 37805777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCTCAGTTTGGCTAAACTGATGGATATTCTGATGTCTAAGGAACCAT[C/A]ATATGTTCGCTGTATAAAACCCAATGATGGTAAACAGCCAGGTGAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Essential Splice Site 724 1026 21 31
Genomic Location (Zv9):
Chromosome 5 (position 39410270)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37209954
GRCz11 5 37810107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGAGGCTACAGAGAGAGAGCCAATTACCATCGCATCCGTCATGCAG[G/A]TCGGCTTTACAAATAGACTGAAAACAGACAGACAATTGTAAGAAGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Essential Splice Site 725 1026 21 31
Genomic Location (Zv9):
Chromosome 5 (position 39410271)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37209955
GRCz11 5 37810108
KASP Assay ID:
554-7706.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAGGCTACAGAGAGAGAGCCAATTACCATCGCATCCGTCATGCAGG[T/A]CGGCTTTACAAATAGACTGAAAACAGACAGACAATTGTAAGAAGAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 730 1026 22 31
ENSDART00000053511 Nonsense 730 1026 22 31
Genomic Location (Zv9):
Chromosome 5 (position 39410373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37210057
GRCz11 5 37810210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCATACCTGTTTTGTCTTTTTTATCTTGCAGTAATTGTCATCCAGT[C/A]ATGGTGGAGAGGCGTCAAAGGCCGTAGGAAAGCCAAGCACCGTAGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 730 1026 22 31
ENSDART00000053511 Nonsense 730 1026 22 31
Genomic Location (Zv9):
Chromosome 5 (position 39410373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37210057
GRCz11 5 37810210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCATACCTGTTTTGTCTTTTTTATCTTGCAGTAATTGTCATCCAGT[C/A]ATGGTGGAGAGGCGTCAAAGGCCGTAGGAAAGCCAAGCACCGTAGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053511 Nonsense 929 1026 27 31
Genomic Location (Zv9):
Chromosome 5 (position 39414278)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37213962
GRCz11 5 37814115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCTGGTCCAGGAAGCAAAAATCAAACAACGTATCGACTACGGTGCAT[T/A]GCTGGGTAATGTTACTGTAATACAGCTCTCTCTATTGTTGGCTAACAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link