si:ch211-232m8.5

Ensembl ID:
ENSDARG00000020901
ZFIN ID:
ZDB-GENE-081028-62
Description:
Novel protein similar to vertebrate gamma-aminobutyric acid (GABA) A receptor, pi (GABRP) [Source:Un
Human Orthologue:
GABRP
Human Description:
gamma-aminobutyric acid (GABA) A receptor, pi [Source:HGNC Symbol;Acc:4089]
Mouse Orthologue:
Gabrp
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, pi Gene [Source:MGI Symbol;Acc:MGI:2387597]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42422 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074819 Nonsense 363 464 10 10
ENSDART00000135608 Nonsense 324 425 8 8
Genomic Location (Zv9):
Chromosome 14 (position 35687159)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34216436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATATTGCATTTTTTTAATCTGTAATTTAATTTTTCACAGGAATTGCTC[A/T]AAGAGTTCGAGGAATCAAATGGCACGACTCACTTGGTCAGTTCGATGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link