cyb5r4

Ensembl ID:
ENSDARG00000020898
ZFIN ID:
ZDB-GENE-050522-225
Description:
Cytochrome b5 reductase 4 [Source:UniProtKB/Swiss-Prot;Acc:Q502I6]
Human Orthologue:
CYB5R4
Human Description:
cytochrome b5 reductase 4 [Source:HGNC Symbol;Acc:20147]
Mouse Orthologue:
Cyb5r4
Mouse Description:
cytochrome b5 reductase 4 Gene [Source:MGI Symbol;Acc:MGI:2386848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42646 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012048 Essential Splice Site 28 527 3 17
Genomic Location (Zv9):
Chromosome 16 (position 4015483)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3173395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCAACGAATGCTTGAATGTAAAACTAACTTTACCTCAGTTTAATTC[A/C]GGTGGTGCTGAAGCCTGGTCACAGTTTGCTGGACTGGATCCGACTGACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link