si:dkey-216e9.4

Ensembl ID:
ENSDARG00000020895
ZFIN ID:
ZDB-GENE-050309-89
Description:
hypothetical protein LOC558108 [Source:RefSeq peptide;Acc:NP_001092206]
Human Orthologues:
AL161445.1, BAG1
Human Descriptions:
BAG family molecular chaperone regulator 1 isoform BAG-1S [Source:RefSeq peptide;Acc:NP_001165886]
BCL2-associated athanogene [Source:HGNC Symbol;Acc:937]
Mouse Orthologue:
Bag1
Mouse Description:
BCL2-associated athanogene 1 Gene [Source:MGI Symbol;Acc:MGI:108047]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32945 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017144 Nonsense 24 206 2 7
Genomic Location (Zv9):
Chromosome 2 (position 30619354)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30920989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGTTCTTGTCTCAGGCACAACCAAACACAGCATCACTTTAACAGGT[C/T]AAGATGGACATGAACCACTGTTGAAGGATTTGTGTGAGGCGCTGACAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link