tmod4

Ensembl ID:
ENSDARG00000020890
ZFIN ID:
ZDB-GENE-991019-9
Description:
tropomodulin-4 [Source:RefSeq peptide;Acc:NP_571271]
Human Orthologue:
TMOD4
Human Description:
tropomodulin 4 (muscle) [Source:HGNC Symbol;Acc:11874]
Mouse Orthologue:
Tmod4
Mouse Description:
tropomodulin 4 Gene [Source:MGI Symbol;Acc:MGI:1355285]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3530 Nonsense Confirmed mutation in F2 line Unknown
sa18609 Nonsense Available for shipment Available now
hu3476 Missense, Splice Site Confirmed mutation in F2 line Unknown
sa22870 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu3530
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
Genomic Location:
Chromosome 16 (position 31913353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAGAGCATAAGGATAGAGATGACCTGGTGCCTTTTACAGGGGAGAAG[A/T]GAGGTACCATCACTACTGGACAGATATTATGAACATGATCGTTCATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
ENSDART00000024294 Nonsense 88 343 2 9
ENSDART00000137153 Nonsense 88 343 3 10
Genomic Location:
Chromosome 16 (position 31913353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATAGAGCATAAGGATAGAGATGACCTGGTGCCTTTTACAGGGGAGAAG[A/T]GAGGTACCATCACTAYTGGACMGATATTAWGAAMATGATCGTTCATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3476
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Missense, Splice Site 89 343 3 9
ENSDART00000137153 Missense, Splice Site 89 343 4 10
Genomic Location:
Chromosome 16 (position 31917221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCACGGTAACAACAGTGTGTATCTTTTTTCTCCACTGCTGTCCGTAG[G/A]GAAAGCCTTCGTTCCTAAACCAGGCTCGGGACAAATCCCAGCGGACGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024294 Nonsense 171 343 5 9
ENSDART00000137153 Nonsense 171 343 6 10
Genomic Location:
Chromosome 16 (position 31922593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTTATTCTCTTTCAGGTGTGGTGAAACCAGATGTGTATAAAATCTA[T/A]CCTGAGGAGCCTCCCAATGACACCAACGTGGAGGAAACTCTCCGCTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9n2hi3fp