gli2b

Ensembl ID:
ENSDARG00000020884
ZFIN ID:
ZDB-GENE-050523-1
Description:
GLI-Kruppel family member GLI2b [Source:RefSeq peptide;Acc:NP_001015069]
Human Orthologue:
GLI2
Human Description:
GLI family zinc finger 2 [Source:HGNC Symbol;Acc:4318]
Mouse Orthologue:
Gli2
Mouse Description:
GLI-Kruppel family member GLI2 Gene [Source:MGI Symbol;Acc:MGI:95728]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6221 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18473 Nonsense Available for shipment Available now
sa7354 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017912 Essential Splice Site 229 1225 5 10
Genomic Location:
Chromosome 11 (position 45030778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCACGATTACGTGTGTGTTCAGTARAGTGTGTATGYCGTTCCCTGC[A/T]GGAGCACCTGAGCAGTGCACAGGACCTGAAGGAGGACATGGACGACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017912 Nonsense 392 1225 8 10
Genomic Location:
Chromosome 11 (position 45018846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCGCAGAAACCCTAYGTGTGTAAGATCCCGGGCTGTACCAAGCGCTA[T/A]ACTGATCCCAGTTCGCTTCGGAAACACGTTAAAACCGTGCACGGGCCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017912 Missense 633 1225 10 10
Genomic Location:
Chromosome 11 (position 45003514)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGCCAGCACTGTGAGCTCTGCGTACACCTTCAGCCGGCGCTCATCYGGAA[T/G]ATCACCATGTTATTCGAGCCGTCGGTCCAGCCAAACATCMCAACCTGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8nnyviwq