LOC794083

Ensembl ID:
ENSDARG00000020876
Human Orthologue:
PDK2
Human Description:
pyruvate dehydrogenase kinase, isozyme 2 [Source:HGNC Symbol;Acc:8810]
Mouse Orthologue:
Pdk2
Mouse Description:
pyruvate dehydrogenase kinase, isoenzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1343087]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2639 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008010 Essential Splice Site 362 409 10 11
Genomic Location (Zv9):
Chromosome 12 (position 30110381)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28447318
KASP Assay ID:
554-2811.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTACTCTATGGAGGGCCATGGCACTGATGCAGTCATTCACCTCAAGG[T/G]ACATTTACACCCAATACTTAACWGAATAGTTTCAAATTYATTCATTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link