nfat5

Ensembl ID:
ENSDARG00000020872
ZFIN ID:
ZDB-GENE-030131-6322
Description:
nuclear factor of activated T-cells 5 [Source:RefSeq peptide;Acc:NP_956189]
Human Orthologue:
NFAT5
Human Description:
nuclear factor of activated T-cells 5, tonicity-responsive [Source:HGNC Symbol;Acc:7774]
Mouse Orthologue:
Nfat5
Mouse Description:
nuclear factor of activated T-cells 5 Gene [Source:MGI Symbol;Acc:MGI:1859333]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44362 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38147 Nonsense Available for shipment Available now
sa12595 Nonsense Available for shipment Available now
sa12205 Nonsense Available for shipment Available now
sa1560 Nonsense Available for shipment Available now
sa32548 Nonsense Available for shipment Available now
sa38146 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017805 Essential Splice Site 25 1416 1 13
Genomic Location (Zv9):
Chromosome 25 (position 38148398)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36550187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCGCCGATATCGACCCCAGTTCTCCCAAATCTCTCTATTCCAAAGG[T/C]AAGAGCTCCTCGTTGTTCTAAAGCCTTCTGGTTTTATTCATTCACACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017805 Nonsense 675 1416 12 13
Genomic Location (Zv9):
Chromosome 25 (position 38126672)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36528461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGTGTCCTTGTCAGAGGACACAACCGTTCTCCAGCCGGTTCCCCCT[C/T]AGGTCCCGCAGCAGTTCTTGCGGGAAACCCCAGAAACACTGTCTCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017805 Nonsense 803 1416 12 13
Genomic Location (Zv9):
Chromosome 25 (position 38126288)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36528077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATACTGGAGAATCTGCAACAGCAGCAGCAGAAGGCTCTCGTGGATCWA[C/T]AGCATCAACAAACTGTCCTGGAAAATCTTCAGCAACATCAGAAAGTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017805 Nonsense 876 1416 12 13
ENSDART00000017805 Nonsense 876 1416 12 13
Genomic Location (Zv9):
Chromosome 25 (position 38126069)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36527858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAATYGTGACTCTGCAGCATCAGAAGGTTCTGGACAATCTCCARCAG[C/T]AGCAACAGCATCAGATTAATCTAGAAACTCTTCAGCATCAGGAGGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017805 Nonsense 876 1416 12 13
ENSDART00000017805 Nonsense 876 1416 12 13
Genomic Location (Zv9):
Chromosome 25 (position 38126069)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36527858
KASP Assay ID:
554-1503.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAATCGTGACTCTGCAGCATCAGAAGGTTCTGGACAATCTCCAGCAG[C/T]AGCAACAGCATCAGATTAATCTAGAAACTCTTCAGCATCAGGAGGTGTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017805 Nonsense 1037 1416 12 13
Genomic Location (Zv9):
Chromosome 25 (position 38125585)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36527374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGAGCAGCAACCTCCTTCAGCTAGTCTGTTTATCGCGCAGAGTGTGT[T/A]ACCAGCATCAGATAACACCCAGAACCAGCCGCCGCAGCAGATCACCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017805 Essential Splice Site 1344 1416 12 13
Genomic Location (Zv9):
Chromosome 25 (position 38124663)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36526452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGGACCGCCAGGACCAGCTGGCCTGTTTCTCTTTGAGATTCCCAGTGG[T/A]AAGAACAGTCATTTAAAAGGTCTCAGGAAATGTTAGTATCAATATGTTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link