si:ch211-258f14.6

Ensembl ID:
ENSDARG00000020871
ZFIN ID:
ZDB-GENE-050506-100
Description:
Novel protein similar to vertebrate protein tyrosine phosphatase, receptor-type, Z polypeptide 1 (PT
Human Orthologue:
PTPRZ1
Human Description:
protein tyrosine phosphatase, receptor-type, Z polypeptide 1 [Source:HGNC Symbol;Acc:9685]
Mouse Orthologue:
Ptprz1
Mouse Description:
protein tyrosine phosphatase, receptor type Z, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:97816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33369 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127751 Essential Splice Site 22 496 2 12
ENSDART00000130818 Essential Splice Site 22 1298 2 30
ENSDART00000133866   None 235 None 6
Genomic Location (Zv9):
Chromosome 4 (position 4748554)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4866735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAATCACTGATCCATTGACTCCAGCTCTCCTCGTCTTTCTCTTTCC[A/T]GATCTGGCCGCTTCGTACCTGAGAGGTCAGCGCAAATTCACAGAGGACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link