trim25l

Ensembl ID:
ENSDARG00000020863
ZFIN ID:
ZDB-GENE-040914-87
Description:
RING+BBOX zinc finger protein [Source:UniProtKB/TrEMBL;Acc:Q6DRJ6]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10522 Essential Splice Site Available for shipment Available now
sa17056 Nonsense Available for shipment Available now
sa7022 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12188 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039204 Essential Splice Site 250 476 2 10
ENSDART00000105278 Essential Splice Site 231 560 3 9
ENSDART00000111817 Essential Splice Site 229 576 3 8
Genomic Location:
Chromosome 6 (position 4034338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGAGAGAGAGCTGAAAGACATGAAGAAAGTCGTAGACACGCTCACGG[T/G]AAACATTCAGCACACCCAGGAAACAGCTYACCTGTTAATGAGTRASAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039204 Nonsense 272 476 3 10
ENSDART00000105278 Nonsense 253 560 4 9
ENSDART00000111817 Nonsense 251 576 4 8
Genomic Location:
Chromosome 6 (position 4035632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGCGAGACGAWGCGGATGCTGTCCTCTCTGAGCTCCAGGAGTCAGTG[C/T]AGCGGATGCTGGATCTGCTGCTGGATGTGATGGTCTCCAGTGGGCAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039204 Essential Splice Site 403 476 5 10
ENSDART00000105278 None None 560 None 9
ENSDART00000111817 Essential Splice Site 382 576 6 8
Genomic Location:
Chromosome 6 (position 4037365)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTTCACWGTGGCAGAACGAAACGGGCAGAAAACTGGCATCATGAAACG[T/C]RAGTGGATTTCATCACACAGCATTTGCTTTTCTGAAATAAAACTCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039204 None None 476 None 10
ENSDART00000105278 Nonsense 451 560 7 9
ENSDART00000111817 Nonsense 470 576 8 8
Genomic Location:
Chromosome 6 (position 4045945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGCCGCTTACCTCTGACCGCTGCTACTGGGAGGTAGAGTGGAGGGGG[C/T]GRGGCTCATCTGTGGGCGTGGTCAGTGGGTCCATGCCTCGSAAAGGGGCR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nfqlxpy2