ef1a

Ensembl ID:
ENSDARG00000020850
ZFIN IDs:
ZDB-GENE-050706-188, ZDB-GENE-990415-52
Description:
Elongation factor 1-alpha [Source:UniProtKB/Swiss-Prot;Acc:Q92005]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23594 Essential Splice Site Available for shipment Available now
sa36916 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023156 Essential Splice Site 48 462 None 8
ENSDART00000039129 Essential Splice Site 48 462 None 8
ENSDART00000129362 Essential Splice Site 48 462 None 8
Genomic Location (Zv9):
Chromosome 19 (position 45288206)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43524259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATCGACAAGAGAACCATCGAGAAGTTCGAGAAGGAAGCCGCTGAGG[T/C]AAGCGTTCAACCGGTTGGATTTATTCTTAATCAATTTATGCGCTTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023156   None 462 None 8
ENSDART00000039129   None 462 None 8
ENSDART00000129362 Essential Splice Site 108 462 3 8
Genomic Location (Zv9):
Chromosome 19 (position 45294181)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43530234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGGACACAGAGACTTCATCAAGAACATGATCACTGGTACTTCTCAGG[T/C]ATGTCTACAACTGTGATTCTAGAAATTTCAATTTTCAAGGATTTTTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link