ef1a

Ensembl ID:
ENSDARG00000020850
ZFIN IDs:
ZDB-GENE-050706-188, ZDB-GENE-990415-52
Description:
Elongation factor 1-alpha [Source:UniProtKB/Swiss-Prot;Acc:Q92005]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23594 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36916 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023156 Essential Splice Site 48 462 None 8
ENSDART00000039129 Essential Splice Site 48 462 None 8
ENSDART00000129362 Essential Splice Site 48 462 None 8
Genomic Location:
Chromosome 19 (position 45288206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATCGACAAGAGAACCATCGAGAAGTTCGAGAAGGAAGCCGCTGAGG[T/C]AAGCGTTCAACCGGTTGGATTTATTCTTAATCAATTTATGCGCTTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023156   None 462 None 8
ENSDART00000039129   None 462 None 8
ENSDART00000129362 Essential Splice Site 108 462 3 8
Genomic Location:
Chromosome 19 (position 45294181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGGACACAGAGACTTCATCAAGAACATGATCACTGGTACTTCTCAGG[T/C]ATGTCTACAACTGTGATTCTAGAAATTTCAATTTTCAAGGATTTTTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link