atp6v0a1a

Ensembl ID:
ENSDARG00000020847
ZFIN ID:
ZDB-GENE-030131-3027
Description:
ATPase, H+ transporting, lysosomal V0 subunit a1 [Source:RefSeq peptide;Acc:NP_997837]
Human Orthologue:
ATP6V0A1
Human Description:
ATPase, H+ transporting, lysosomal V0 subunit a1 [Source:HGNC Symbol;Acc:865]
Mouse Orthologue:
Atp6v0a1
Mouse Description:
ATPase, H+ transporting, lysosomal V0 subunit A1 Gene [Source:MGI Symbol;Acc:MGI:103286]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19970 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19971 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017646 Essential Splice Site 39 834 2 21
Genomic Location:
Chromosome 3 (position 16549657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCTGTGTCAGTGAGCTGGGGGAGATCGGCATGGTGCAGTTCAGAGAT[G/A]TAAGTGCAGACCATTTCATTATGTAACATTGACCTCATTGTCATCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017646 Essential Splice Site 392 834 11 21
Genomic Location:
Chromosome 3 (position 16576234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATCGTTGATGCATACGGCATCAGCAACTACCGGGAGATGAACCCAGG[T/A]AACTCTGACCTCTCACCTTCAGAGTCAATCACACTTTAAAATAAGGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/13mup0sc