si:ch211-148j1.1

Ensembl ID:
ENSDARG00000020845
ZFIN ID:
ZDB-GENE-030131-6933
Description:
Novel protein similar to vertebrate tensin 1 (TNS1) [Source:UniProtKB/TrEMBL;Acc:B0R0Y9]
Human Orthologue:
TNS1
Human Description:
tensin 1 [Source:HGNC Symbol;Acc:11973]
Mouse Orthologue:
Tns1
Mouse Description:
tensin 1 Gene [Source:MGI Symbol;Acc:MGI:104552]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7213 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27484 Nonsense Mutation detected in F1 DNA During 2017
sa17234 Nonsense Available for shipment Available now
sa10585 Essential Splice Site Available for shipment Available now
sa27483 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 361 1769 13 31
ENSDART00000134480   None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48630200)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47851708
KASP Assay ID:
554-4396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCTGCATCACYATTGAACCGGGCCTGCTTYTGAAAGGAGACATACTGG[T/C]AAGAATAAGGRAATATACSGCATACGCAGTTAAAGTCAGTATTAWTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27484
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Nonsense 396 1769 14 31
ENSDART00000134480   None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48625686)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47847194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTCAGTTTCACACCTGTGCTGTTCATGATCTGGGTATCGTCTTCGGC[A/T]AAGATGAGCTTGATGAAACCTTTAAAGGTATGCTTTATTTTATTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Nonsense 771 1769 17 31
ENSDART00000134480   None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48583144)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47804803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTACTACAATCCCACAGCCTTCCAGAGTTCCCTCAGATGGCATCTCAA[C/T]AAGAGATTGAGCAGTCCATTGAAGCCCTCAAMATGCTGATGCTGGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 949 1769 17 31
ENSDART00000134480   None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48582608)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47804267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGRTAGCAGCTACAAATTGGAGGGTCTTGTAGCTCACCGTGTAGCTGG[T/C]AAGATCAACCTCGAAATACYTTTTTAACAGTCAGTTTWYTTGCTCAYATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015159 Essential Splice Site 1056 1769 19 31
ENSDART00000134480   None 722 None 13

The following transcripts of ENSDARG00000020845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 48564724)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 47787432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACCCCTGCCTTCCCTGTCTCGCCACAAACCCCTTACTTCAACATGT[G/A]TAAGTTCCCAATTTGGAGGAGGAGGGCGCCATAGAGCTCTAGAATAAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Pulmonary function: Genome-wide association study identifies five loci associated with lung function. (View Study)
  • Pulmonary function (interaction): Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link