mcrs1

Ensembl ID:
ENSDARG00000020840
ZFIN ID:
ZDB-GENE-040426-2434
Description:
microspherule protein 1 [Source:RefSeq peptide;Acc:NP_998438]
Human Orthologue:
MCRS1
Human Description:
microspherule protein 1 [Source:HGNC Symbol;Acc:6960]
Mouse Orthologue:
Mcrs1
Mouse Description:
microspherule protein 1 Gene [Source:MGI Symbol;Acc:MGI:1858420]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4399 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002545 Essential Splice Site None 472 1 15
Genomic Location:
Chromosome 11 (position 3361767)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTTAAAATTTATTCGAAGTCTAATCTCACCGAAACTCATTCTAAAGG[T/A]AAGCCATACCTCTGAACKTGTTGATTTTGCCGCTTAAATGTCTTGTTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q1jzo1k8