neurod6b

Ensembl ID:
ENSDARG00000020794
ZFIN IDs:
ZDB-GENE-010608-2, ZDB-GENE-010608-2
Description:
Neurogenic differentiation factor 6-B [Source:UniProtKB/Swiss-Prot;Acc:Q9W6C7]
Human Orthologue:
NEUROD6
Human Description:
neurogenic differentiation 6 [Source:HGNC Symbol;Acc:13804]
Mouse Orthologue:
Neurod6
Mouse Description:
neurogenic differentiation 6 Gene [Source:MGI Symbol;Acc:MGI:106593]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39946 Missense, Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Missense, Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018150 Missense 198 317 2 2
ENSDART00000111135 Splice Site, Nonsense 195 311 5 7
Genomic Location (Zv9):
Chromosome 2 (position 51234887)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50894020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTCTGGCAGGCCCGCGTACGATTCCCTGTACCCATACCCGAACGCCG[A/T]AATGGCCACGCCCACCGGCCTCAGCTCTGGGACGCGAGAAAGCGTCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link