lama4

Ensembl ID:
ENSDARG00000020785
ZFIN ID:
ZDB-GENE-040724-213
Description:
laminin subunit alpha-4 [Source:RefSeq peptide;Acc:NP_001034154]
Human Orthologue:
LAMA4
Human Description:
laminin, alpha 4 [Source:HGNC Symbol;Acc:6484]
Mouse Orthologue:
Lama4
Mouse Description:
laminin, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:109321]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4876 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36927 Nonsense Mutation detected in F1 DNA During 2016
sa23614 Nonsense Available for shipment Available now
sa43357 Nonsense Mutation detected in F1 DNA During 2016
sa43358 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32265 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15496 Nonsense Available for shipment Available now
sa36928 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10261 Nonsense Available for shipment Available now
sa15046 Essential Splice Site Available for shipment Available now
sa36929 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Essential Splice Site 67 1871 3 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 242963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCWWTGCTTAACCCCCCCCAAACACTCCTTTTCTGCATCATCTGTTTC[A/T]GGATTGTCGGGACCACACTCTTGGAGATTTCTGTGAGCWGTGTGAAGAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 323 1871 8 40
ENSDART00000133785 Nonsense 188 374 4 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 249713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGAGAACTGTGACCTGCACACAGGAGAGTGTCTGCCTGAGCTCTCG[C/T]AAATCAGCGAGTGTAATATCAGTGAGTTCAGTCACAAAAACAAACCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 438 1871 11 40
ENSDART00000133785 Nonsense 303 374 7 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 251716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAATTTGGGAAACCAAGTGGATCAAGAGACACTGAACAGCTCCACA[C/T]GAGCAAAGACCCTCACTGCTAACCTGTCATCGCTCAATGTCCTCATTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 558 1871 13 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 252388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCCTTCAAGCTCAGGATCTCCTTAGCAAAGCTGAAGACGCACTGAAA[C/T]AGGCCATCAACAAATACAAGAGCAACCAGCTCAAACTACAGAGGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Essential Splice Site 574 1871 13 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 252439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCATCAACAAATACAAGAGCAACCAGCTCAAACTACAGAGGAGAGAG[G/A]TGCCTTTTTATTTATGATGCATTTTCTTTCATGAACTGATGACTAATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Essential Splice Site 741 1871 17 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 255318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGCAAAAGTGTTGAATGAAGCATCGTCCCTACACTTTCAGCAGCAAG[G/A]TACAGCAGAGAGAGCTCTTTCCATGCTTTTCTACTGTTTGTTTTTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 795 1871 19 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 258076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTRAAGATCGTACCCCGAAGCGTCTGCAGTTCACTCAGGAAGTRGCT[G/T]AGGGCACTCTGAACCGCTCCGCTGAGGTGTTGGAGAAAGTGACTCCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Essential Splice Site 944 1871 21 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931 Essential Splice Site 55 955 1 20
Genomic Location:
Chromosome 20 (position 259478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGACCCCATAGAGGATCGCTTCTTGCTTTACCTCGGAGACAAACAAG[T/C]GAGCACCGGCGAGGGGGAAGTGGGCCTGAGCATGTGTTATTAACACCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 1105 1871 25 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931 Nonsense 216 955 5 20
Genomic Location:
Chromosome 20 (position 264363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTTTCMGGCACAAGCTGGCTTTCTCTCAGAGTCGTGTCACCAGTTA[T/A]TTGTTTGACGGCACCGGCTACGCTTTAGTCAACAACATTGAGAGGCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Essential Splice Site 1193 1871 26 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931 Essential Splice Site 304 955 6 20
Genomic Location:
Chromosome 20 (position 266259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGACTAACTTAGCCAAACTGCAGATCAATGACGCTCGCTATCACGAG[G/A]TAATGTTTTCCAGCAGTACATCACGTTATATCTTTAAACACAGCGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 1198 1871 27 40
ENSDART00000133785   None 374 None 8
ENSDART00000138931   None 955 None 20
Genomic Location:
Chromosome 20 (position 266357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTCTTTGTAACACCCTGTCATTTTCCCCTCAGGTGTCTGTGATCTA[T/A]CATCATTCAAAGAAGATCATTTTGTTGGTGGACAGAAGCCATGTCAAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link