lama4

Ensembl ID:
ENSDARG00000020785
ZFIN ID:
ZDB-GENE-040724-213
Description:
laminin subunit alpha-4 [Source:RefSeq peptide;Acc:NP_001034154]
Human Orthologue:
LAMA4
Human Description:
laminin, alpha 4 [Source:HGNC Symbol;Acc:6484]
Mouse Orthologue:
Lama4
Mouse Description:
laminin, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:109321]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4876 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23614 Nonsense Available for shipment Available now
sa15496 Nonsense Available for shipment Available now
sa10261 Nonsense Available for shipment Available now
sa15046 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Essential Splice Site 67 1871 3 40
ENSDART00000133785 None None 374 None 8
ENSDART00000138931 None None 955 None 20
Genomic Location:
Chromosome 20 (position 242963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCWWTGCTTAACCCCCCCCAAACACTCCTTTTCTGCATCATCTGTTTC[A/T]GGATTGTCGGGACCACACTCTTGGAGATTTCTGTGAGCWGTGTGAAGAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 438 1871 11 40
ENSDART00000133785 Nonsense 303 374 7 8
ENSDART00000138931 None None 955 None 20
Genomic Location:
Chromosome 20 (position 251716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAATTTGGGAAACCAAGTGGATCAAGAGACACTGAACAGCTCCACA[C/T]GAGCAAAGACCCTCACTGCTAACCTGTCATCGCTCAATGTCCTCATTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 795 1871 19 40
ENSDART00000133785 None None 374 None 8
ENSDART00000138931 None None 955 None 20
Genomic Location:
Chromosome 20 (position 258076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTRAAGATCGTACCCCGAAGCGTCTGCAGTTCACTCAGGAAGTRGCT[G/T]AGGGCACTCTGAACCGCTCCGCTGAGGTGTTGGAGAAAGTGACTCCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Nonsense 1105 1871 25 40
ENSDART00000133785 None None 374 None 8
ENSDART00000138931 Nonsense 216 955 5 20
Genomic Location:
Chromosome 20 (position 264363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTTTCMGGCACAAGCTGGCTTTCTCTCAGAGTCGTGTCACCAGTTA[T/A]TTGTTTGACGGCACCGGCTACGCTTTAGTCAACAACATTGAGAGGCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002661 Essential Splice Site 1193 1871 26 40
ENSDART00000133785 None None 374 None 8
ENSDART00000138931 Essential Splice Site 304 955 6 20
Genomic Location:
Chromosome 20 (position 266259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGACTAACTTAGCCAAACTGCAGATCAATGACGCTCGCTATCACGAG[G/A]TAATGTTTTCCAGCAGTACATCACGTTATATCTTTAAACACAGCGTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2kmfeus9