col4a2

Ensembl ID:
ENSDARG00000020781
ZFIN ID:
ZDB-GENE-070725-3
Description:
Type IV collagen alpha 2 chain [Source:UniProtKB/TrEMBL;Acc:Q58FS6]
Human Orthologue:
COL4A2
Human Description:
collagen, type IV, alpha 2 [Source:HGNC Symbol;Acc:2203]
Mouse Orthologue:
Col4a2
Mouse Description:
collagen, type IV, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88455]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4351 Missense F2 line generated During 2014
sa5521 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18379 Essential Splice Site Available for shipment Available now
sa21438 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4351
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011757 None None 1037 None 22
ENSDART00000081513 Missense 107 1697 5 48
Genomic Location:
Chromosome 9 (position 8892460)
KASP Assay ID:
554-2430.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGGCCCCCAGGGTCCCACAGGCCCTAAAGGGCGACAGGGAGAGCCTG[G/A]CCTTCAGGGCCCTAAAGGAATGAAGGGAGAGCATGGCGAAGCAGGCTTYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011757 None None 1037 None 22
ENSDART00000081513 Essential Splice Site 238 1697 11 48
Genomic Location:
Chromosome 9 (position 8895938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATCTCTTCTTCTYACTGTTTTTACTCATTTATTTATTTATTTATTTA[G/T]GGTCCTCAAGGTCTGAAAGGTGCCAAGGGACAAAAGGTAATAAAACACRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011757 None None 1037 None 22
ENSDART00000081513 Essential Splice Site 524 1697 22 48
Genomic Location:
Chromosome 9 (position 8901869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGGTGATCAGGGAGATCCAGGARCCAAAGGTSCCAATGGTTTGCCTG[T/C]AAGTTGCCAACAYCACATCTTGTTGTCACACGGYTTAWGAAAATCTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011757 Nonsense 422 1037 10 22
ENSDART00000081513 Nonsense 1079 1697 36 48
Genomic Location:
Chromosome 9 (position 8922486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCATAAACAAAAAAATGTTTATAAAGGATTCCTTTATTTAAGGTGACT[T/A]GGGGCCTACCATCAGTCTTCCAGGATCAACAGGACTGAGAGGTGAAACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/esre7820