si:ch211-112m17.3

Ensembl ID:
ENSDARG00000020777
ZFIN ID:
ZDB-GENE-041014-309
Description:
Novel protein similar to human chromosome 6 open reading frame 204 (C6orf204) [Source:UniProtKB/TrEM
Human Orthologue:
C6orf204
Human Description:
chromosome 6 open reading frame 204 [Source:HGNC Symbol;Acc:21638]
Mouse Orthologue:
Gm9766
Mouse Description:
predicted gene 9766 Gene [Source:MGI Symbol;Acc:MGI:3642684]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23786 Nonsense Available for shipment Available now
sa23787 Nonsense Available for shipment Available now
sa31047 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061141 Nonsense 173 781 3 13
ENSDART00000146349   None 433 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 41938891)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42010050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCACCTCTCGACATCCCCCTGGACATGAAGGATCCCCGTCCCGTGCGT[C/T]GATGGTCCTCCCTCACCCGCCTCACCGCCCAAGAAAAGCCCTCTCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061141 Nonsense 248 781 3 13
ENSDART00000146349   None 433 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 41939118)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42010277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTATGACCTGGGTAGCAGCAACACTTTAGGTAAATCGGACTCATGTTG[T/A]TCATCTCCCCTGAAGCCGAGTACACTAGACCTCAGTTTTAGTGCCTTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061141 Essential Splice Site 667 781 11 13
ENSDART00000146349 Essential Splice Site 319 433 8 10
Genomic Location (Zv9):
Chromosome 20 (position 41986714)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42057873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGAGCGTGAGGAGGAACTGGACACGCTCTCCACCACTCTTAAACAG[G/C]TACAGCACTCTAAAACCACCTGCTACAGGACTCTAAGATACCGCTGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link