tnr

Ensembl ID:
ENSDARG00000020771
ZFIN ID:
ZDB-GENE-030804-1
Description:
tenascin-R [Source:RefSeq peptide;Acc:NP_919364]
Human Orthologue:
TNR
Human Description:
tenascin R (restrictin, janusin) [Source:HGNC Symbol;Acc:11953]
Mouse Orthologue:
Tnr
Mouse Description:
tenascin R Gene [Source:MGI Symbol;Acc:MGI:99516]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5152 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8089 Nonsense Mutation detected in F1 DNA During 2014
sa6854 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015827 Essential Splice Site None 1350 4 24
ENSDART00000143787 None None 156 None 3
Genomic Location:
Chromosome 2 (position 35111235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGAAGGGAAGTGTTCTGAAGAGCTAAAATGGTCTCTTTTTGTCCACA[G/A]TGCCAATCAGAGGTCTATTTGTGGAGTTGATGATCTCACCCTAGTGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015827 Nonsense 292 1350 5 24
ENSDART00000143787 None None 156 None 3
Genomic Location:
Chromosome 2 (position 35116821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAGTGCCGATCCGGCTTCCTGGGGGAAGACTGCTCKCTCATCTTCTG[C/A]GCTAATAACTGCAGCCAGAGAGGKGTGTGCAAGGAGGGCTTCTGCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015827 Nonsense 475 1350 8 24
ENSDART00000143787 None None 156 None 3
Genomic Location:
Chromosome 2 (position 35134486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACCATCACATCTTTCCACCAAACGGGACTGAAGCCTGGAGAAGAATA[C/A]ACTGTCAACCTGGTGGCCCTGAAAGACCAAGGCAGGAGCCTGCCTGYTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tonometry: Framingham Heart Study 100K Project: genome-wide associations for blood pressure and arterial stiffness. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ylbzpr54