tnr

Ensembl ID:
ENSDARG00000020771
ZFIN ID:
ZDB-GENE-030804-1
Description:
tenascin-R [Source:RefSeq peptide;Acc:NP_919364]
Human Orthologue:
TNR
Human Description:
tenascin R (restrictin, janusin) [Source:HGNC Symbol;Acc:11953]
Mouse Orthologue:
Tnr
Mouse Description:
tenascin R Gene [Source:MGI Symbol;Acc:MGI:99516]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30599 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa6854 Nonsense Mutation detected in F1 DNA During 2016
sa31286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015827 Splice Site, Nonsense 409 1350 7 24
ENSDART00000143787   None 156 None 3
Genomic Location (Zv9):
Chromosome 2 (position 35130544)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35427254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGCACATAGGACGGAGGCCAATAATGCATCAATCTGTACCTTTCAGA[T/G]CTCTCAAATCCAGACGGTTTACTCTTCAAATCCATCATGGAGACATCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015827 Nonsense 475 1350 8 24
ENSDART00000143787   None 156 None 3
Genomic Location (Zv9):
Chromosome 2 (position 35134486)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35431196
KASP Assay ID:
554-5300.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACCATCACATCTTTCCACCAAACGGGACTGAAGCCTGGAGAAGAATA[C/A]ACTGTCAACCTGGTGGCCCTGAAAGACCAAGGCAGGAGCCTGCCTGYTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015827 Nonsense 1287 1350 23 24
ENSDART00000143787   None 156 None 3
Genomic Location (Zv9):
Chromosome 2 (position 35189747)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35486457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAGGACAAAGACAATGACATTGCTGTCACCAACTGTGCACTGTCTTA[C/A]AAGGGAGCCTGGTGGTACAAAAACTGTCATCGGGCAAACCTTAACGGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tonometry: Framingham Heart Study 100K Project: genome-wide associations for blood pressure and arterial stiffness. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link