arrdc2

Ensembl ID:
ENSDARG00000020761
ZFIN ID:
ZDB-GENE-030131-7146
Description:
arrestin domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_956233]
Human Orthologue:
ARRDC2
Human Description:
arrestin domain containing 2 [Source:HGNC Symbol;Acc:25225]
Mouse Orthologue:
Arrdc2
Mouse Description:
arrestin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918057]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19002 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011362 Essential Splice Site 92 407 1 8
ENSDART00000139889 None None 402 None 8
Genomic Location:
Chromosome 11 (position 13714481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGATGAAGTGGAGTACCTGAACCGGAGAGAAGTGCTTCTGCAGGCAGG[T/G]CAGTCATTCACTGATAGGGACGATGTGTGCTTATAGCAGATCAGATAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z0ebluxn