ef1

Ensembl ID:
ENSDARG00000020759
ZFIN ID:
ZDB-GENE-980526-335
Description:
ETS-related transcription factor Elf-1 [Source:RefSeq peptide;Acc:NP_571234]
Human Orthologue:
ELF4
Human Description:
E74-like factor 4 (ets domain transcription factor) [Source:HGNC Symbol;Acc:3319]
Mouse Orthologue:
Elf4
Mouse Description:
E74-like factor 4 (ets domain transcription factor) Gene [Source:MGI Symbol;Acc:MGI:1928377]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15316 Essential Splice Site Available for shipment Available now
sa22532 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002965 Essential Splice Site 169 434 5 10
ENSDART00000122369 Essential Splice Site 169 639 5 9
Genomic Location:
Chromosome 14 (position 42077817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGAAGTCCCTCAGAAAAACTTTTCCAAGCCTGCCAGGAAAACCAAAG[G/A]TACCATAATCCACCAGTAGAAGGCAGTGTGTGCCTCATGTATTTTTGNNNNNNNCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002965 None None 434 10 10
ENSDART00000122369 Nonsense 475 639 9 9
Genomic Location:
Chromosome 14 (position 42069652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTACTTTAAGCTCATCCAGCGGAGGGGTCATCAGCACCACGCCACAG[C/T]AGACCGCATCTCTGAACGGCATCACCCGCTTGGTCACTCTCAATGCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d734ivay