tmem178

Ensembl ID:
ENSDARG00000020758
ZFIN ID:
ZDB-GENE-060929-756
Description:
Transmembrane protein 178 [Source:UniProtKB/Swiss-Prot;Acc:Q08CE6]
Human Orthologue:
TMEM178
Human Description:
transmembrane protein 178 [Source:HGNC Symbol;Acc:28517]
Mouse Orthologue:
Tmem178
Mouse Description:
transmembrane protein 178 Gene [Source:MGI Symbol;Acc:MGI:1915277]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9980 Nonsense Available for shipment Available now
sa1210 Nonsense F2 line generated During 2015
sa27806 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa9980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008594 Nonsense 116 301 1 4
Genomic Location:
Chromosome 11 (position 31389898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGGYATTTTGGAGACGGAGTGCGGGCGCCCGCTTTTCTCCACCTAYT[C/A]GGGACTATGGAGGAAATGCTACTTCCAGGGAATGGACAGGGATATTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1210
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008594 Nonsense 155 301 2 4
Genomic Location:
Chromosome 11 (position 31395491)
KASP Assay ID:
554-1119.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTGCAGAGCGATGCACATCTGTCAAGTACCATTTCTCCCAACCCATC[A/T]GACTCAGGAACATCCCTCTCAACCTGACGAGGACCATACAGCAGGACGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa27806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008594 Essential Splice Site 176 301 3 4
Genomic Location:
Chromosome 11 (position 31401635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATAAGGTGTGAGTTGGCTAAGTGGGCGATATGTGTGTGTGTGTTTC[A/T]GATCTGCGGCGCATCACGGCAGGGTTTTTGGGCATGGCAGCAGCCGTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7wk44fgt