tmem178

Ensembl ID:
ENSDARG00000020758
ZFIN ID:
ZDB-GENE-060929-756
Description:
Transmembrane protein 178 [Source:UniProtKB/Swiss-Prot;Acc:Q08CE6]
Human Orthologue:
TMEM178
Human Description:
transmembrane protein 178 [Source:HGNC Symbol;Acc:28517]
Mouse Orthologue:
Tmem178
Mouse Description:
transmembrane protein 178 Gene [Source:MGI Symbol;Acc:MGI:1915277]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9980 Nonsense Available for shipment Available now
sa1210 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa9980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008594 Nonsense 116 301 1 4
Genomic Location:
Chromosome 11 (position 31389898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGGYATTTTGGAGACGGAGTGCGGGCGCCCGCTTTTCTCCACCTAYT[C/A]GGGACTATGGAGGAAATGCTACTTCCAGGGAATGGACAGGGATATTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1210
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008594 Nonsense 155 301 2 4
Genomic Location:
Chromosome 11 (position 31395491)
KASP Assay ID:
554-1119.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTGCAGAGCGATGCACATCTGTCAAGTACCATTTCTCCCAACCCATC[A/T]GACTCAGGAACATCCCTCTCAACCTGACGAGGACCATACAGCAGGACGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7wk44fgt