caprin2

Ensembl ID:
ENSDARG00000020749
ZFIN ID:
ZDB-GENE-040812-2
Description:
Caprin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RJ80]
Human Orthologue:
CAPRIN2
Human Description:
caprin family member 2 [Source:HGNC Symbol;Acc:21259]
Mouse Orthologue:
Caprin2
Mouse Description:
caprin family member 2 Gene [Source:MGI Symbol;Acc:MGI:2448541]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12716 Nonsense Available for shipment Available now
sa6049 Nonsense Mutation detected in F1 DNA During 2014
sa12256 Nonsense Available for shipment Available now
sa14869 Nonsense Available for shipment Available now
sa5256 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 200 914 5 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location:
Chromosome 4 (position 15694236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGCTACATGTCCACTCAAGACATGGAGGGTTTGATGGATTTGGCRT[C/G]ACTGGTGGGATGYAAAAGGGATTACAGCATTAGGTTTGCACTATTGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 384 914 10 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location:
Chromosome 4 (position 15692089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACTGTAGAGAAAATKTGTTAAACTTCTGTCTCTTTTTCTAGAAACGT[C/T]AAAGAAAGAAGGCTGAGCAAGACTCCAAATCTGTGAGTTTTTGATCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 390 914 10 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location:
Chromosome 4 (position 15692071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTAAACTTCTGTCTCTTTTTCTAGAAACGTYAAAGAAAGAAGGCTGAG[C/T]AAGACTCCAAATCTGTGAGTTTTTGATCAGAGGATCCANNNNAACCTTKGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Nonsense 438 914 12 21
ENSDART00000064009 None None 331 None 6
ENSDART00000125323 None None 329 None 7
Genomic Location:
Chromosome 4 (position 15691763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGTTTTTTAAATSCCCAATATAATNNNNGTTTGCAGGAGTCTCTTT[T/A]GGATGGAGAATCTTCACCTGYSAACWCTCAAACAAAAAGATGCCGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040708 Essential Splice Site 708 914 20 21
ENSDART00000064009 Essential Splice Site 125 331 5 6
ENSDART00000125323 Essential Splice Site 123 329 5 7
Genomic Location:
Chromosome 4 (position 15684756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAATGATGTACTTTTGACCCTGCTAATTGTAGTTTNGGTTGCATTATC[A/T]GGAAAACGGCTATCAGCAAAACTTCAAGAGAGGAGCAGGCACAGCAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/krrdrj0s