gfi1.1

Ensembl ID:
ENSDARG00000020746
ZFIN ID:
ZDB-GENE-050522-534
Description:
growth factor independent 1.1 [Source:RefSeq peptide;Acc:NP_001018612]
Human Orthologue:
GFI1
Human Description:
growth factor independent 1 transcription repressor [Source:HGNC Symbol;Acc:4237]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9056 Nonsense Mutation detected in F1 DNA During 2014
sa11633 Nonsense Available for shipment Available now
sa18719 Nonsense Mutation detected in F1 DNA During 2014
sa16850 Nonsense Available for shipment Available now
sa18720 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8077 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 101 385 4 7
ENSDART00000136677 Nonsense 4 288 1 4
Genomic Location:
Chromosome 2 (position 10567708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGNCAAAATAGCTCATTATACTTTTTCATATCTGACTGTAGATCTGGAT[A/T]AATGCCCGGTTCCTTCTCCAGACGACTCTCAGCCTTTCGACATGTCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 145 385 4 7
ENSDART00000136677 Nonsense 48 288 1 4
Genomic Location:
Chromosome 2 (position 10567841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAGGCATCTCATTCAGTCCTGCAATCGTGTTTCTGTGGATTCAGACT[C/A]GTCAGTGGGRGTTTAYGATGCTATGGACAGAAGGYCGAGCGCTCATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 238 385 5 7
ENSDART00000136677 Nonsense 141 288 2 4
Genomic Location:
Chromosome 2 (position 10570766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTGTAATTAGGTGTTTTCCACTCCCCATGGCTTGGAAGTTCACGTG[C/T]GAAGGTCACACAGCGGCACAAGGCCCTTTGCCTGCGAAATCTGTGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Nonsense 309 385 6 7
ENSDART00000136677 Nonsense 212 288 3 4
Genomic Location:
Chromosome 2 (position 10571063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACCTTCTCATCCACTCGGACACCAGACCGTATCCCTGTCAGTACTGC[G/T]GAAAACGYTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
Genomic Location:
Chromosome 2 (position 10571119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGG[T/C]GAATCATTTTAGCATTCAACACAAAGATTTGCTTACTATGGGGAGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
ENSDART00000015379 Essential Splice Site 327 385 6 7
ENSDART00000136677 Essential Splice Site 230 288 3 4
Genomic Location:
Chromosome 2 (position 10571119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTTCCATCAGAAATCTGATATGAAGAAGCACACGTTCATTCATACAGG[T/C]GAATCATTTTAGCATTCAACACAAAKATTTGCTTACTATGGGGAGAYACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/18754k22