bdkrb1

Ensembl ID:
ENSDARG00000020744
ZFIN ID:
ZDB-GENE-030814-1
Description:
B1 bradykinin receptor [Source:RefSeq peptide;Acc:NP_898896]
Human Orthologue:
BDKRB1
Human Description:
bradykinin receptor B1 [Source:HGNC Symbol;Acc:1029]
Mouse Orthologue:
Bdkrb1
Mouse Description:
bradykinin receptor, beta 1 Gene [Source:MGI Symbol;Acc:MGI:88144]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42847 Nonsense Mutation detected in F1 DNA During 2017
sa42846 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024027 Nonsense 74 359 1 1
Genomic Location (Zv9):
Chromosome 17 (position 2612512)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2658157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGGTATTCCTGCTCCAGAGAGGCCGATGGTCCGTCCCAGAGATCTA[C/A]CTGGGAAATCTGGCACTAGCTGACCTTATTTTACTAGTCTGCTTGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024027 Nonsense 309 359 1 1
Genomic Location (Zv9):
Chromosome 17 (position 2611807)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2657452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTGTATATTTGGCGTTCTCGAATAGCTGCTTGAACCCGGTGCTGTA[T/A]GTTTGCTCAGGAAACTATTTCAGGAGGAAAGTCAGCAGCATCTATAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link