fga

Ensembl ID:
ENSDARG00000020741
ZFIN ID:
ZDB-GENE-031010-21
Description:
fibrinogen alpha chain [Source:RefSeq peptide;Acc:NP_001181918]
Human Orthologue:
FGA
Human Description:
fibrinogen alpha chain [Source:HGNC Symbol;Acc:3661]
Mouse Orthologue:
Fga
Mouse Description:
fibrinogen alpha chain Gene [Source:MGI Symbol;Acc:MGI:1316726]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa651 Essential Splice Site F2 line generated During 2014
sa12469 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa651
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033118 Essential Splice Site 19 684 2 6
ENSDART00000080442 None None 206 None 2
ENSDART00000135522 Essential Splice Site 19 456 2 5

The following transcripts of ENSDARG00000020741 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 9146216)
KASP Assay ID:
554-0559.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGGCCTATGTTGGCAGACCTAANGTAGTTATAAAGTACTTACTTTTT[A/C]GGCCGAGGAGGACACAGTGGTGAACCCTAGAGGYGCTCGTCCTATTGAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033118 Nonsense 400 684 5 6
ENSDART00000080442 None None 206 None 2
ENSDART00000135522 Nonsense 400 456 5 5

The following transcripts of ENSDARG00000020741 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 9143431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGTATGCCTCATCTTCATCCTCAACATCCACAAAGAYAGTGTCAGAT[G/T]GAAGCAAARGTTACTCAAAGACCACCCTCACTAGCGACCCTATTTTTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • D-dimer levels: Genetic predictors of fibrin D-dimer levels in healthy adults. (View Study)
  • Fibrinogen: Assessment of genetic determinants of the association of γ' fibrinogen in relation to cardiovascular disease. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)
  • Venous thromboembolism: Genetics of venous thrombosis: insights from a new genome wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/32j9xz98