EFCAB6

Ensembl ID:
ENSDARG00000020735
Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Human Orthologue:
EFCAB6
Human Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Mouse Orthologue:
Efcab6
Mouse Description:
EF-hand calcium binding domain 6 Gene [Source:MGI Symbol;Acc:MGI:1924877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9883 Essential Splice Site Available for shipment Available now
sa7530 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019765 Essential Splice Site 270 1082 7 25
Genomic Location (Zv9):
Chromosome 25 (position 19492956)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18904933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGACTGTGAAAACTATCGAAAAATCCCACCAGATTCAGTACAACTTGG[T/C]ACAGTTTTGCAAAATACACTGATGTAATATGATAAAGCCTTTATAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019765 Missense 801 1082 20 25
Genomic Location (Zv9):
Chromosome 25 (position 19486621)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18898598
KASP Assay ID:
554-4194.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTTTAAAGCTAATAGCCTTTTTTTTTTTTTTCAGAAAGGACGGAATT[C/T]TTGACAATGCATGTGATCAAGTTCATGAGTACCTAGCAGCCAYTGCACAM
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link