EFCAB6

Ensembl ID:
ENSDARG00000020735
Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Human Orthologue:
EFCAB6
Human Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Mouse Orthologue:
Efcab6
Mouse Description:
EF-hand calcium binding domain 6 Gene [Source:MGI Symbol;Acc:MGI:1924877]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9883 Essential Splice Site Available for shipment Available now
sa5100 Nonsense Mutation detected in F1 DNA During 2014
sa3319 Nonsense Mutation detected in F1 DNA During 2014
sa7530 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019765 Essential Splice Site 270 1082 7 25
Genomic Location:
Chromosome 25 (position 19492956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGACTGTGAAAACTATCGAAAAATCCCACCAGATTCAGTACAACTTGG[T/C]ACAGTTTTGCAAAATACACTGATGTAATATGATAAAGCCTTTATAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019765 Nonsense 600 1082 16 25
Genomic Location:
Chromosome 25 (position 19488669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTRCAGGGAAGAAAAGGCACATGAAGCTTCCATACTGGACATAAAAGCA[C/T]AAGCAATAAAGGAKGTTGTCTWGAGGAAACTCAAAGACAGGCTTCAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019765 Nonsense 607 1082 16 25
Genomic Location:
Chromosome 25 (position 19488647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGCTTCCATACTGGACATAAAAGCACAAGCAATAAAGGAKGTTGTCT[T/A]GAGGAAACTCAAAGACAGGCTTCAGAGGAAAGGGRTGACTCTTCAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019765 Missense 801 1082 20 25
Genomic Location:
Chromosome 25 (position 19486621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTTTAAAGCTAATAGCCTTTTTTTTTTTTTTCAGAAAGGACGGAATT[C/T]TTGACAATGCATGTGATCAAGTTCATGAGTACCTAGCAGCCAYTGCACAM
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/exqckfnp