mdkb

Ensembl ID:
ENSDARG00000020708
ZFIN ID:
ZDB-GENE-010131-6
Description:
midkine-related growth factor b [Source:RefSeq peptide;Acc:NP_571791]
Human Orthologue:
MDK
Human Description:
midkine (neurite growth-promoting factor 2) [Source:HGNC Symbol;Acc:6972]
Mouse Orthologue:
Mdk
Mouse Description:
midkine Gene [Source:MGI Symbol;Acc:MGI:96949]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24609 Essential Splice Site Available for shipment Available now
sa38006 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32516 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003042 Essential Splice Site 26 147 2 4
Genomic Location:
Chromosome 25 (position 8143233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGTGGTGGTCTCGATGATCACTGTTGAAGCCAGTATGAAGAAAAAAG[G/A]TTCTTATCTCAAAATATTTACAAGACATACTTCTTTTATGCATATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003042 Essential Splice Site 83 147 3 4
ENSDART00000003042 Essential Splice Site 83 147 3 4
Genomic Location:
Chromosome 25 (position 8143480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAACCAAGTGCAAAGTCCCATGCAACTGGAAGAAGGACTTTGGCGG[T/A]AAGCAGTTATGCAGTACATCATGTATAAATACATTCCGACAGACCACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003042 Essential Splice Site 83 147 3 4
ENSDART00000003042 Essential Splice Site 83 147 3 4
Genomic Location:
Chromosome 25 (position 8143480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAACCAAGTGCAAAGTCCCATGCAACTGGAAGAAGGACTTTGGCGG[T/A]AAGCAGTTATGCAGTACATCATGTATAAATACATTCCGACAGACCACTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link