sesn1

Ensembl ID:
ENSDARG00000020693
ZFIN ID:
ZDB-GENE-040718-408
Description:
sestrin-1 [Source:RefSeq peptide;Acc:NP_001002660]
Human Orthologue:
SESN1
Human Description:
sestrin 1 [Source:HGNC Symbol;Acc:21595]
Mouse Orthologue:
Sesn1
Mouse Description:
sestrin 1 Gene [Source:MGI Symbol;Acc:MGI:2155278]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14435 Essential Splice Site Available for shipment Available now
sa23741 Nonsense Available for shipment Available now
sa29391 Nonsense Mutation detected in F1 DNA During 2017
sa44943 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062993 Essential Splice Site 56 488 2 10
ENSDART00000147448 Essential Splice Site 56 499 2 10
Genomic Location (Zv9):
Chromosome 20 (position 32264383)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32322623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCAGACCAGTGGGAAATGGACCAAGTAGATTTATACCAGAGAAAGAG[G/A]TGAGCGTTAACATCTGCCCCGCTTGCTCAAAGTTAACAKAAATCTGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062993 Nonsense 68 488 3 10
ENSDART00000147448 Nonsense 79 499 3 10
Genomic Location (Zv9):
Chromosome 20 (position 32264605)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32322845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCCTGTTGTCCCAGATACTTCAAGTCAGTAAATTGGATGAAAGGACA[C/T]AGTCGATTTTTGAGGATGCCTTTGCAGTGCTTGGTCGCCTCGACAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062993 Nonsense 145 488 4 10
ENSDART00000147448 Nonsense 156 499 4 10
Genomic Location (Zv9):
Chromosome 20 (position 32264921)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32323161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGTGCACGTATCTGGTCAACCTGCACGTGAATGACTTCCTGCAGGTC[G/T]GAGGTGATCCGAAGTGGTTGAATGGTCTGGAAGAAGCCCCACGGAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062993 Nonsense 323 488 7 10
ENSDART00000147448 Nonsense 334 499 7 10
Genomic Location (Zv9):
Chromosome 20 (position 32266500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGCTCAACAGAAGATGAGGAGTGTGTGCCATCCAGAGATGTTTCG[C/T]GACACTTTGAAGACCCTAGTTATGGCTATAAAGACTTCTCCAGGAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link