clpp

Ensembl ID:
ENSDARG00000020679
ZFIN ID:
ZDB-GENE-030131-7860
Description:
putative ATP-dependent Clp protease proteolytic subunit, mitochondrial [Source:RefSeq peptide;Acc:N
Human Orthologue:
CLPP
Human Description:
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) [Source:HGNC Symbo
Mouse Orthologue:
Clpp
Mouse Description:
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12373 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006604 Essential Splice Site 37 266 2 7
ENSDART00000131951 Essential Splice Site 37 266 3 8
ENSDART00000136900 Essential Splice Site 37 220 2 7
Genomic Location:
Chromosome 3 (position 34221128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTCTCCATGGARCAGTCCACTCATACCTATAGTTGTGGAGCAGACGG[T/C]AAGAACACAATGTCATTAAATTCAATAGTTTTATATTAAAGATACAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tdqfpvco