dpp3

Ensembl ID:
ENSDARG00000020676
ZFIN ID:
ZDB-GENE-030131-1247
Description:
dipeptidyl peptidase 3 [Source:RefSeq peptide;Acc:NP_001002683]
Human Orthologue:
DPP3
Human Description:
dipeptidyl-peptidase 3 [Source:HGNC Symbol;Acc:3008]
Mouse Orthologue:
Dpp3
Mouse Description:
dipeptidylpeptidase 3 Gene [Source:MGI Symbol;Acc:MGI:1922471]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10887 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011305 Nonsense 33 727 2 18
ENSDART00000139634 Nonsense 33 118 2 3

The following transcripts of ENSDARG00000020676 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26735733)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27304644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATTGCCGGGAGGCTTTCAAGCTGCTGTCTCYCAAAGAGAAACTGTA[T/A]GCACACTACCTCTCTCGGGCGGCCTGGTACGGTGGCCTGGTCGTGTTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link