LOC100151449

Ensembl ID:
ENSDARG00000020671
Human Orthologue:
HEATR1
Human Description:
HEAT repeat containing 1 [Source:HGNC Symbol;Acc:25517]
Mouse Orthologue:
Heatr1
Mouse Description:
HEAT repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442524]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22040 Nonsense Mutation detected in F1 DNA During 2016
sa35219 Nonsense Mutation detected in F1 DNA During 2016
sa31858 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011102 Nonsense 540 2159 13 45
Genomic Location:
Chromosome 12 (position 10424411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATAAAAGATGATTCTCCAGAAGTTGTGCTGTCTGCACTTAAAGCCTTG[C/T]AGGTGAGATCACGATGTCATGGATGTTATGCATTTTGATAAGTTACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011102 Nonsense 891 2159 20 45
Genomic Location:
Chromosome 12 (position 10408589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAGTTGGATTGTCGAGTCAGTGCCATTCTTCAGACTCAGGCTCTTTA[T/A]GTGGGAAAGGCTTTTCTGTCCAGCCAGCCTGTAAAAACCCTCAACCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011102 Nonsense 1396 2159 30 45
Genomic Location:
Chromosome 12 (position 10393429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGCTCTTCCTCATGTGCCCGAGCACAGACGGTTACCCATCCTCAGC[C/T]AGCTGATGAGCACACTGGGCCCGTCCCGCTTCCTCTGGGTGCTGATGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link