gtdc1

Ensembl ID:
ENSDARG00000020642
ZFIN ID:
ZDB-GENE-050417-8
Description:
Glycosyltransferase-like domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q568B7]
Human Orthologue:
GTDC1
Human Description:
glycosyltransferase-like domain containing 1 [Source:HGNC Symbol;Acc:20887]
Mouse Orthologue:
Gtdc1
Mouse Description:
glycosyltransferase-like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2444269]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10288 Essential Splice Site Available for shipment Available now
sa9220 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2539 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
Genomic Location:
Chromosome 9 (position 26904582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAGTGTCACGTCCTCCACTTCCCCATTCGCTTTCCCGATGTCACAAG[G/A]TCTGTCCTTACATCCCTCACCACAGCCTTCCAGGGATCACTCCTCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
Genomic Location:
Chromosome 9 (position 26904582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAGTGTCACGTCCTCCACTTCCCCATTCGCTTTCCCGATGTCACAAG[G/A]TCTGTCCTTACATCCCTCACCACAGCCTTCCAGGGATCACTCCTCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 5 11
ENSDART00000127135 Essential Splice Site 174 433 4 10
Genomic Location:
Chromosome 9 (position 26920563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGTTTCTCTTATGTTGCTTTATAGGGCTTTTTTCCCTTTCGTCCTCA[G/A]ATTCCTCCCTGCACACAAGCGTCTCAGGCATCCAGTGCGGTGTGATGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/22j600uv