gtdc1

Ensembl ID:
ENSDARG00000020642
ZFIN ID:
ZDB-GENE-050417-8
Description:
Glycosyltransferase-like domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q568B7]
Human Orthologue:
GTDC1
Human Description:
glycosyltransferase-like domain containing 1 [Source:HGNC Symbol;Acc:20887]
Mouse Orthologue:
Gtdc1
Mouse Description:
glycosyltransferase-like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2444269]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10288 Essential Splice Site Available for shipment Available now
sa9220 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
Genomic Location (Zv9):
Chromosome 9 (position 26904582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26060368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAGTGTCACGTCCTCCACTTCCCCATTCGCTTTCCCGATGTCACAAG[G/A]TCTGTCCTTACATCCCTCACCACAGCCTTCCAGGGATCACTCCTCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
ENSDART00000024572 Essential Splice Site 174 433 4 11
ENSDART00000127135 Essential Splice Site 174 433 3 10
Genomic Location (Zv9):
Chromosome 9 (position 26904582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26060368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAGTGTCACGTCCTCCACTTCCCCATTCGCTTTCCCGATGTCACAAG[G/A]TCTGTCCTTACATCCCTCACCACAGCCTTCCAGGGATCACTCCTCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024572 Nonsense 379 433 10 11
ENSDART00000127135 Nonsense 379 433 9 10
Genomic Location (Zv9):
Chromosome 9 (position 26942374)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26098160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATATGTATTTTCCTCTTGTAGCAACATATCTGTATTCAACACCTGAA[C/T]AGCTGTGCAAAAGACTACAGGAATTCTGCAAGCGTCCGCAATTAGCCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link